View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17301_high_8 (Length: 225)

Name: NF17301_high_8
Description: NF17301
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17301_high_8
NF17301_high_8
[»] chr2 (1 HSPs)
chr2 (111-208)||(31241122-31241219)


Alignment Details
Target: chr2 (Bit Score: 98; Significance: 2e-48; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 111 - 208
Target Start/End: Original strand, 31241122 - 31241219
Alignment:
111 gctaatgattatatggtatattcaaccttttgtccaacatagatgatgttgttaaactatcaaaatcctatgtgtagtcttcattctacaaatgaaag 208  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31241122 gctaatgattatatggtatattcaaccttttgtccaacatagatgatgttgttaaactatcaaaatcctatgtgtagtcttcattctacaaatgaaag 31241219  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University