View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17301_high_8 (Length: 225)
Name: NF17301_high_8
Description: NF17301
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17301_high_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 98; Significance: 2e-48; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 111 - 208
Target Start/End: Original strand, 31241122 - 31241219
Alignment:
| Q |
111 |
gctaatgattatatggtatattcaaccttttgtccaacatagatgatgttgttaaactatcaaaatcctatgtgtagtcttcattctacaaatgaaag |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31241122 |
gctaatgattatatggtatattcaaccttttgtccaacatagatgatgttgttaaactatcaaaatcctatgtgtagtcttcattctacaaatgaaag |
31241219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University