View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17301_low_6 (Length: 258)
Name: NF17301_low_6
Description: NF17301
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17301_low_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 21 - 245
Target Start/End: Original strand, 2090540 - 2090764
Alignment:
| Q |
21 |
atgcgattacgccatgagtgcgagacacacatagcctttgattgatccttcatagatagcccaccaaagatttttgtttgaagctctgtggggagacggt |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
2090540 |
atgcgattacgccatgagtgcgagacacacatagcctttgattgatccttcatagatagcccaccaaagatttttgtttgaagctctgtggggagatggt |
2090639 |
T |
 |
| Q |
121 |
tgaataaggatttaggcttccttatccccattgtcctcttctttctaaaaattttaccctccatttaaagagtgattatgattatcaagaagaattgata |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2090640 |
tgaataaggatttaggcttccttatccccattgtcctcttctttctaaaaattttaccctccatttaaagagtgattatgattatcaagaagaattgata |
2090739 |
T |
 |
| Q |
221 |
aagataatgataggcgagtgtgatg |
245 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
2090740 |
aagataatgataggcgagtgtgatg |
2090764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 36; Significance: 0.00000000002; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 25 - 164
Target Start/End: Complemental strand, 2878793 - 2878654
Alignment:
| Q |
25 |
gattacgccatgagtgcgagacacacatagcctttgattgatccttcatagatagcccaccaaagatttttgtttgaagctctgtggggagacggttgaa |
124 |
Q |
| |
|
||||||||||| | ||||||||||||||| ||||||||||||| || || | || || ||| ||||| ||||||| | | |||||||| |||||| |
|
|
| T |
2878793 |
gattacgccattcattcgagacacacatagcttttgattgatcctccaacgacaacctacaaaatattttcgtttgaatatttatggggagattgttgaa |
2878694 |
T |
 |
| Q |
125 |
taaggatttaggcttccttatccccattgtcctcttcttt |
164 |
Q |
| |
|
|||||| | ||||||||| ||||||| || ||||||||| |
|
|
| T |
2878693 |
gaaggatctgggcttccttttccccatagttctcttcttt |
2878654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 30 - 71
Target Start/End: Original strand, 2727332 - 2727373
Alignment:
| Q |
30 |
cgccatgagtgcgagacacacatagcctttgattgatccttc |
71 |
Q |
| |
|
||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
2727332 |
cgccatgagtgtgagacacacatagcttttgattgatccttc |
2727373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University