View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17302_high_15 (Length: 396)
Name: NF17302_high_15
Description: NF17302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17302_high_15 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 326; Significance: 0; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 326; E-Value: 0
Query Start/End: Original strand, 1 - 383
Target Start/End: Complemental strand, 48536598 - 48536215
Alignment:
| Q |
1 |
tgcatttgttgtttctctttttggatggatgttctgattgcttcttcttctttttcatattttagggcttacgtctcttacttcaagtggtgggccgggt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48536598 |
tgcatttgttgtttctctttttggatggatgttctgattgcttcttcttctttttcatattttagggcttacgtctcttacttcaagtggtgggccgggt |
48536499 |
T |
|
| Q |
101 |
taaactgtgttgcgggctatgtggcactagcagt-----tagcagtctgtgattccaatcccgtctgtcattccaatcccaatacgatgactgaggtatt |
195 |
Q |
| |
|
||||||| |||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| | |
|
|
| T |
48536498 |
taaactgcgttgcgggctatgttgcactagcagtagctttagcagtctgtgattccaatcccgtctgtcattccaatcccaatacgatgactaaggtact |
48536399 |
T |
|
| Q |
196 |
aatatcttttgtaccaatttgcttcttcgcaagttaagccttcttcagttgccttggaggaaacctctctcacatagatcagatcaacactcgtagattc |
295 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48536398 |
aatatcttttgtaccaatttgcttcttcgcaagttaagccttcttcagttgccttggaggaaacctctctcacatagatcagatcaacactcgtagattc |
48536299 |
T |
|
| Q |
296 |
tgggtcctcaggctattggggtatcttacatctctatgtggcttatgttcaatattattcactgtggtaacttacatcctctcaactg |
383 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
48536298 |
cgggtcctcaggctatt-gggtatcttacatctctatgtggcttatgtt---tattattcactgtggtaacttacatcctctcaactg |
48536215 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 210 - 373
Target Start/End: Complemental strand, 48533452 - 48533292
Alignment:
| Q |
210 |
caatttgcttcttcgcaagttaagccttcttcagttgccttggaggaaacctctctcacatagatcagatcaacactcgtagattctgggtcctcaggct |
309 |
Q |
| |
|
||||||||||||| |||||| ||||||||| | |||| | | || |||||||||||| ||||||||||||||||| || ||| | ||| || | | |
|
|
| T |
48533452 |
caatttgcttctttgcaagtggcgccttcttctttagcctcgcaagagacctctctcacaaagatcagatcaacactcataccttccgcatccgcaagtt |
48533353 |
T |
|
| Q |
310 |
attggggtatcttacatctctatgtggcttatgttcaatattattcactgtggtaacttacatc |
373 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| | ||||||||| ||||||| |||||||| |
|
|
| T |
48533352 |
attggggtctcttacatctctatgtggcttatgct---tattattcattgtggtatcttacatc |
48533292 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University