View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17302_high_36 (Length: 288)
Name: NF17302_high_36
Description: NF17302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17302_high_36 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 162; Significance: 2e-86; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 70 - 275
Target Start/End: Complemental strand, 52042494 - 52042289
Alignment:
| Q |
70 |
ataagctgtcaaatgatatatacaggctcaaccaannnnnnnnaggggagtttaagcatgaggcaatctaaaatttatgtttcctccatatataaataca |
169 |
Q |
| |
|
|||| |||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52042494 |
ataaactgtcaaatgatatatacaggctcgaccaattttttttaggggagtttaagcatgaggcaatctaaaatttatgtttcctccatatataaataca |
52042395 |
T |
|
| Q |
170 |
atttaaaaatttgtcgaatgattcatttacctctgttggcaaccgcttatgacagctttcaccataatctatttttgaacctgccttgcaaattgcatca |
269 |
Q |
| |
|
||||| |||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52042394 |
atttataaatttgtcgaatgattcatttacgtctgttggcaaccgcttacgacagctttcaccataatctatttttgaacctgccttgcaaattgcatca |
52042295 |
T |
|
| Q |
270 |
ttacct |
275 |
Q |
| |
|
|||||| |
|
|
| T |
52042294 |
ttacct |
52042289 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University