View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17302_high_46 (Length: 250)
Name: NF17302_high_46
Description: NF17302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17302_high_46 |
 |  |
|
| [»] scaffold0198 (1 HSPs) |
 |  |
|
Alignment Details
Target: scaffold0198 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: scaffold0198
Description:
Target: scaffold0198; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 7 - 250
Target Start/End: Complemental strand, 2300 - 2040
Alignment:
| Q |
7 |
tcgaacaatatcgtcggatgttttgtgtattttaaattttctagatttactctgaacattgtattagacgtaatggcctcgatttatagtggtatggggt |
106 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
2300 |
tcgagcaaaatcgtcggatgttttgtgtattttaaattttctagatttactctgaacattgtattagacgtaatggcctcgatttatagtgggatggggt |
2201 |
T |
 |
| Q |
107 |
gcggggtgtgaatagatcattcccttaaaattcataaattttaaaaatattt-----------------ttatgcgatgaaacgataaaaggattgcaga |
189 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||| || |
|
|
| T |
2200 |
gcggggtgtgaatagatcgttcccttaaaattcataaatttaaaaaatatttttattttagaaatatttttatgcgatgaaacgataaaaggattgcgga |
2101 |
T |
 |
| Q |
190 |
ctaattatcgagttaagaaatatgatcaaaataaatacaaattaacttgagaatgttaatt |
250 |
Q |
| |
|
|| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
2100 |
cttattatcgagttaagaaatatgatcaaaatagatacaaattaacttgagaatgttaatt |
2040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University