View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17302_high_47 (Length: 245)

Name: NF17302_high_47
Description: NF17302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17302_high_47
NF17302_high_47
[»] chr5 (1 HSPs)
chr5 (1-230)||(31085205-31085435)


Alignment Details
Target: chr5 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 230
Target Start/End: Complemental strand, 31085435 - 31085205
Alignment:
1 tgctaataa-taacacctttcagtactagttttgatagaagcatgatatattacatatatatgccagttatgtgagagaaagaaataaatacagggtgat 99  Q
    ||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
31085435 tgctaataagtaacacctgtcagtactagttttgatagaagcatgatatattacatatatatgccagttatgagagagaaagaaataaatacagggtgat 31085336  T
100 attatataatgaactacaaattgtttactactcggctatgataattaacagactagtacgggcatgaaaatttacatatatataccgtacaacagaccat 199  Q
    |||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31085335 attatataatgaacaacaaattgtttaccactcggctatgataattaacagactagtacgggcatgaaaatttacatatatataccgtacaacagaccat 31085236  T
200 ttaatgcatcttttcaacctatgcatatcat 230  Q
    |||||| ||||||||||||||||||||||||    
31085235 ttaatgtatcttttcaacctatgcatatcat 31085205  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University