View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17302_high_55 (Length: 218)
Name: NF17302_high_55
Description: NF17302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17302_high_55 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 3 - 199
Target Start/End: Original strand, 52807575 - 52807771
Alignment:
| Q |
3 |
aactgtttggttattccatgcaaagtttctatggctttctctgcttctgagcttaatggtggcgctgtcgtaagccatggcagcatctctttcagatttg |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52807575 |
aactgtttggttattccatgcaaagtttctatggctttctctgcttctgagcttaatggtggcgctgtcgtaagccatggcagcatctctttcagatttg |
52807674 |
T |
|
| Q |
103 |
aatgtccctaaccatattctttggtgatttgcatatatttgtgcaccccaatgtccattttgttgaggcacaacccctttcaacttttcacaccctg |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52807675 |
aatgtccctaaccatattctttggtgatttgcatatatttgtgcaccccaatgtccattttgttgaggcacaacccctttcaacttttcacaccctg |
52807771 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University