View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17302_high_60 (Length: 204)
Name: NF17302_high_60
Description: NF17302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17302_high_60 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 109; Significance: 5e-55; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 109; E-Value: 5e-55
Query Start/End: Original strand, 1 - 109
Target Start/End: Complemental strand, 8798204 - 8798096
Alignment:
| Q |
1 |
ctatcttccccaatatattcatcatcatcagcatagtagtagtaggtaacttgttttctcctcctcgatttgatcgttcctagctcactatttattacta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8798204 |
ctatcttccccaatatattcatcatcatcagcatagtagtagtaggtaacttgttttctcctcctcgatttgatcgttcctagctcactatttattacta |
8798105 |
T |
 |
| Q |
101 |
cctctctcc |
109 |
Q |
| |
|
||||||||| |
|
|
| T |
8798104 |
cctctctcc |
8798096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 139 - 187
Target Start/End: Complemental strand, 8798066 - 8798018
Alignment:
| Q |
139 |
cttgcttgttctcttgtctctcactccactgcttttgtatggcaggggt |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8798066 |
cttgcttgttctcttgtctctcactccactgcttttgtatggcaggggt |
8798018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University