View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17302_low_21 (Length: 361)
Name: NF17302_low_21
Description: NF17302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17302_low_21 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 151; Significance: 8e-80; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 151; E-Value: 8e-80
Query Start/End: Original strand, 116 - 350
Target Start/End: Complemental strand, 1353609 - 1353375
Alignment:
| Q |
116 |
ggaaacaagttatatcgaataaatggtaatgagcggtttgaccaaatccggttcaacgttgtagccaacggttcttccactaaattcaaaccggggtttc |
215 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |||||||||||| ||| ||||||||||||||||||||||||||| ||||||||||||| ||||||| |
|
|
| T |
1353609 |
ggaaacaagttataccgaataaatggtaatgagtggtttgaccaaacccgattcaacgttgtagccaacggttcttcctctaaattcaaaccagggtttc |
1353510 |
T |
 |
| Q |
216 |
tacatatttaaatttcaattttggtctagatgtgattcttttattgcattgtaaagnnnnnnnnggcatatggagtatagnnnnnnnnggaagaacgaga |
315 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||| | |
|
|
| T |
1353509 |
tacatatttaaatctcaattttggtctagatgtgattcttttattgcattgtaaagttttttttggcatatggagtatagttttttttggaagaacgaaa |
1353410 |
T |
 |
| Q |
316 |
tcactgctattccaccttgatgttaattcttctca |
350 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| |
|
|
| T |
1353409 |
tcactgctattccaccttgatgttaattcatctca |
1353375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 10 - 59
Target Start/End: Complemental strand, 1353701 - 1353652
Alignment:
| Q |
10 |
ttacatgatttgattatgtgaatatttaaaaagattaggttatttgattg |
59 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
1353701 |
ttacatgatttgattatgtaaatatttaaaaagattaggttatttgattg |
1353652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University