View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17302_low_25 (Length: 345)
Name: NF17302_low_25
Description: NF17302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17302_low_25 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 313; Significance: 1e-176; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 313; E-Value: 1e-176
Query Start/End: Original strand, 1 - 330
Target Start/End: Original strand, 2620513 - 2620838
Alignment:
| Q |
1 |
aaaatatatattaaaatcataaagatcatgaaagcatctttagattgtcacgtatgcatgcatggtattatgatttaattagatttgttcagccgttaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2620513 |
aaaatatatattaaaatcataaagatcatgaaagcatctttagattgtcacgtatgcatgcatggtattatgatttaattagatttgttcagccgttaag |
2620612 |
T |
|
| Q |
101 |
ttgatcggttgttgctgaaattgattggtttgataatgatatttttgtttcatatagataggatggatggtggataacttatttgtgcctcttctagtct |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2620613 |
ttgatcggttgttgctgaaattgattggtttgataatgatatttttgtttcatatag----gatggatggtggataacttatttgtgcctcttctagtct |
2620708 |
T |
|
| Q |
201 |
tctattcacataggtttctaaaatttgacttattttaccatttctacttaaattcatggaaagtggagctttagctattttagtgtatattcacctttga |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2620709 |
tctattcacataggtttctaaaatttgacttattttaccatttctacttaaattcatggaaagtggagctttagctattttagtgtatattcacctttga |
2620808 |
T |
|
| Q |
301 |
acaatttagtttttcagtagttgaactata |
330 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
2620809 |
acaatttagtttttcagtagttgaactata |
2620838 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University