View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17302_low_33 (Length: 311)
Name: NF17302_low_33
Description: NF17302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17302_low_33 |
 |  |
|
| [»] chr7 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 232; Significance: 1e-128; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 311
Target Start/End: Original strand, 32321696 - 32322015
Alignment:
| Q |
1 |
tgtcagatcttatcattagttcttttcatgactaaaaatatattgttcctccaaagtgagaaaatatacataggtggtacaatgctat------------ |
88 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
32321696 |
tgtcagatcttatcattagttctaa--atgactaaaaatatattgttcatccaaagtgagaaaatatacataggtggtacaacgctatcattactatcaa |
32321793 |
T |
 |
| Q |
89 |
---ttcaaattcaaatggcagcttgtgatcattgaaattgtggagaatatatagcaatgatgctaaagcatagaaaatcttgtttgtttagatccaaatt |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32321794 |
ggtttcaaattcaaatggcagcttgtgatcattgaaattgtggagaata----gcaatgatgctaaagcatagaaaatcttgtttgtttagatccaaatt |
32321889 |
T |
 |
| Q |
186 |
acagacacagacctcttttgaaacacttgtcggtactataaggtgatgcttcgaaaagatgaaccaacctacacacaagaaatctttacactcaaaatgg |
285 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32321890 |
acagacacagacctcttttgaaacacttgtcggtactataaggtgatgcttcgaaaagatgaaccaacctacacacaagaaatctttacactcaaaatgg |
32321989 |
T |
 |
| Q |
286 |
cacgcacaattgcacaatactgcagc |
311 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
32321990 |
cacgcacaattgcacaatactgcagc |
32322015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 95 - 127
Target Start/End: Original strand, 32320366 - 32320398
Alignment:
| Q |
95 |
ttcaaatggcagcttgtgatcattgaaattgtg |
127 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
32320366 |
ttcaaatggcagcttgtgatcattgaaattgtg |
32320398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University