View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17302_low_47 (Length: 261)
Name: NF17302_low_47
Description: NF17302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17302_low_47 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 19 - 254
Target Start/End: Complemental strand, 2097277 - 2097042
Alignment:
| Q |
19 |
agattaatcatgtgggagtttcaaaggctctttatctgaaggagtttttgaggnnnnnnnnacgagttttaggtctaagaaaaaccaaggtttggtctgg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
2097277 |
agattaatcatgtgggagtttcaaaggctctttatctgaaggagtttttgag-ttttttttacgagtcttaggtctaagaaaaaccaaagtttggtctgg |
2097179 |
T |
 |
| Q |
119 |
cttt-agtttggcacgttgttgtgtggaccatttggaatttctgcaatgaaatgatttaatttctccaggggtcttggtttggctgtatcattggttctc |
217 |
Q |
| |
|
|||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2097178 |
cttttagtttggcacgttgttgtgtgaaccatttggaatttctgcaatgaaatgatttaatttctccaggggtcttggtttggctgtatcattggttctc |
2097079 |
T |
 |
| Q |
218 |
tctgatgttgggggttctgtggggggtttctctgctg |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2097078 |
tctgatgttgggggttctgtggggggtttctctgctg |
2097042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University