View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17302_low_48 (Length: 256)
Name: NF17302_low_48
Description: NF17302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17302_low_48 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 94; Significance: 6e-46; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 94; E-Value: 6e-46
Query Start/End: Original strand, 15 - 168
Target Start/End: Original strand, 24413303 - 24413455
Alignment:
| Q |
15 |
agattggttatcaactttcagtgtcactgcttcctcctttccttcttctttgatgcttagctcagtcatcaatgcatctagctaagcagattgacaaaca |
114 |
Q |
| |
|
||||||||||||||| || |||||||||||||| |||||||||||||| ||||||||||| |||||||||||||||||||||||||||| ||||| || |
|
|
| T |
24413303 |
agattggttatcaacctttagtgtcactgcttcttcctttccttcttcattgatgcttag-tcagtcatcaatgcatctagctaagcagcccgacaagca |
24413401 |
T |
|
| Q |
115 |
ctcattgcaacaaaaatgtattcagactcacaggttgatagagcaaccgctaat |
168 |
Q |
| |
|
||||||||||| | |||||||||||||||||| || |||||||||||| ||||| |
|
|
| T |
24413402 |
ctcattgcaacgacaatgtattcagactcacaagtagatagagcaaccactaat |
24413455 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 215 - 253
Target Start/End: Original strand, 24413453 - 24413491
Alignment:
| Q |
215 |
aatatcctgcagtactcttcctatcatctttatcaccac |
253 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
24413453 |
aatatcctgcagtactcttcttatcatctttatcaccac |
24413491 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University