View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17302_low_49 (Length: 253)
Name: NF17302_low_49
Description: NF17302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17302_low_49 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 1 - 243
Target Start/End: Original strand, 31085431 - 31085673
Alignment:
| Q |
1 |
tagcaatcaattattattttcaacgataaaattttacgatttttgataggatagaaccatgcatttatcttttaactgatgtgtacatgtgtgtgtacaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
31085431 |
tagcaatcaattattattttcaacgataaaattttacgatttttgataggatagaaccatgcatctatcttttaactgatgtgtacatgtgtgtgtacaa |
31085530 |
T |
 |
| Q |
101 |
atataccatgcatgttccttgataagcctatagtgctgggtgtaggaggtatttggattctctacggtgttgtcgatgacccatgacaagaatatggggg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31085531 |
atataccatgcatgttccttgataagcctatagtgctgggtgtaggaggtatttggattctctacggtgttgtcgatgacccatgacaagaatatggggg |
31085630 |
T |
 |
| Q |
201 |
aaggccaaaaatccgcagcacaaacagaccactgcggcctatg |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31085631 |
aaggccaaaaatccgcagcacaaacagaccactgcggcctatg |
31085673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University