View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17302_low_52 (Length: 244)
Name: NF17302_low_52
Description: NF17302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17302_low_52 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 12 - 240
Target Start/End: Original strand, 9772671 - 9772899
Alignment:
| Q |
12 |
tatatttctctgctcagcagtgaaaatgttttagaaattgaaatttacaacatctttatcttacaaaattggcagtgctttagcatctgaatgcactttg |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
9772671 |
tatatttctctgctcagcagtgaaaatgttttagaaattgaaatttataacatctttatcttataaaattggcagtgctttagcatctgaatgcactttg |
9772770 |
T |
 |
| Q |
112 |
acctgccttggatcaaaggttattgatttacataagtgtgttatctaactccattaaagttcatagagacaaaaatatagacaaatagaaactagttggc |
211 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9772771 |
acctgccttggatcaaaggttatggatttacatacgtgtgttatctaactccattaaagttcatagagacaaaaatatagacaaatagaaactagttggc |
9772870 |
T |
 |
| Q |
212 |
acacataacaaactcaatttacccctatg |
240 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
9772871 |
acacataacaaactcaatttacccctatg |
9772899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University