View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17302_low_55 (Length: 238)
Name: NF17302_low_55
Description: NF17302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17302_low_55 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 1 - 217
Target Start/End: Original strand, 7406936 - 7407152
Alignment:
| Q |
1 |
atatctcactgttatacagtttggttatattagtttctaaagtatatatgtgacggtggaatgtgattaaccgaagtgtaatattcttttgtattgataa |
100 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||| |||||||||| |||||||||||||| |
|
|
| T |
7406936 |
atatctcattgttatacagtttggttatattagtttctaaagtatatatgtgacggtggaatgtgattgatcgatgtgtaatatttttttgtattgataa |
7407035 |
T |
|
| Q |
101 |
tgcatacaaattaaactggatttttattattaactaaacacgatcttctttagtcatggacgaatctaccatttaaaacttaaacacccaactaaaaatt |
200 |
Q |
| |
|
| |||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
7407036 |
tacatacaaattaaactgaatttttattattaactaaacacaatcttctttagtcatggacgaatctaccatttaaaacttaaacaccaaactaaaaatt |
7407135 |
T |
|
| Q |
201 |
aaggtgaatgtatcccc |
217 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
7407136 |
aaggtgaatgtatcccc |
7407152 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University