View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17302_low_55 (Length: 238)

Name: NF17302_low_55
Description: NF17302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17302_low_55
NF17302_low_55
[»] chr8 (1 HSPs)
chr8 (1-217)||(7406936-7407152)


Alignment Details
Target: chr8 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 1 - 217
Target Start/End: Original strand, 7406936 - 7407152
Alignment:
1 atatctcactgttatacagtttggttatattagtttctaaagtatatatgtgacggtggaatgtgattaaccgaagtgtaatattcttttgtattgataa 100  Q
    |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||| |||||||||| ||||||||||||||    
7406936 atatctcattgttatacagtttggttatattagtttctaaagtatatatgtgacggtggaatgtgattgatcgatgtgtaatatttttttgtattgataa 7407035  T
101 tgcatacaaattaaactggatttttattattaactaaacacgatcttctttagtcatggacgaatctaccatttaaaacttaaacacccaactaaaaatt 200  Q
    | |||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
7407036 tacatacaaattaaactgaatttttattattaactaaacacaatcttctttagtcatggacgaatctaccatttaaaacttaaacaccaaactaaaaatt 7407135  T
201 aaggtgaatgtatcccc 217  Q
    |||||||||||||||||    
7407136 aaggtgaatgtatcccc 7407152  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University