View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17302_low_57 (Length: 237)
Name: NF17302_low_57
Description: NF17302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17302_low_57 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 124; Significance: 6e-64; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 34 - 161
Target Start/End: Complemental strand, 15179937 - 15179810
Alignment:
| Q |
34 |
ttgttcattttccaacacaattgctagccagacattttggtcaaggctttagtgtactcaagggttttcccacatcttgttggctacctttattattgtt |
133 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15179937 |
ttgttcattttccaacacaattgctagccagacattttggtcaaggcttaagtgtactcaagggttttcccacatcttgttggctacctttattattgtt |
15179838 |
T |
 |
| Q |
134 |
tggtgagacttaaattgatggagttatt |
161 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
15179837 |
tggtgagacttaaattgatggagttatt |
15179810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 182 - 222
Target Start/End: Complemental strand, 15179742 - 15179702
Alignment:
| Q |
182 |
aagattaagacataccaccatattcaatgcacgaaatattt |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15179742 |
aagattaagacataccaccatattcaatgcacgaaatattt |
15179702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University