View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17302_low_63 (Length: 210)
Name: NF17302_low_63
Description: NF17302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17302_low_63 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 1 - 195
Target Start/End: Complemental strand, 9772637 - 9772443
Alignment:
| Q |
1 |
tgaatgttaacttttacaaatttaaccgataacgtaatatattattactcattagaagcaactatgaaatccattaatttgacataaggcatgattttgg |
100 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
9772637 |
tgaatgttaacttttacaaatttacccgataacataatatattattactcattaaaagcaactatgaaatccattaacttgacataaggcatgattttgg |
9772538 |
T |
|
| Q |
101 |
tgacattgtatttttgaaacactgtttattaattcagaacccccaattcatctttgtgcctgttgtatactaatgtactttgtgcctgttgtata |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9772537 |
tgacattgtatttttgaaacactgtttattaattcagaacccccaattcatctttgtgcctgttgtatactaatgtactttgtgcctgttgtata |
9772443 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University