View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17303_high_28 (Length: 343)
Name: NF17303_high_28
Description: NF17303
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17303_high_28 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 322; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 322; E-Value: 0
Query Start/End: Original strand, 18 - 343
Target Start/End: Original strand, 10741181 - 10741506
Alignment:
| Q |
18 |
cacagaggttatgaggaatgttgttaatataacggttagtagggttatcgcgttgtattacttgagaggaatgcaatcgagcacacaattttgctttctg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
10741181 |
cacagaggttatgaggaatgttgttaatataacggttagtagggttatcgcgttgtattacttgagaggaatgcaatctagcacacaattttgctttctg |
10741280 |
T |
|
| Q |
118 |
agagcgttgactcggaatcttggaagtgcttgtttggggtctctatttgtgccaacaattgaagcgctgagaattgttgctagggggctgaatttgcttg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10741281 |
agagcgttgactcggaatcttggaagtgcttgtttggggtctctatttgtgccaacaattgaagcgctgagaattgttgctagggggctgaatttgcttg |
10741380 |
T |
|
| Q |
218 |
agggagaagatgagttcatgttttgttgcgctcgttgttgtttgggagtcatgcaatcaattttcagaaatggcaatagttgggcatatgtacaggtaac |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10741381 |
agggagaagatgagttcatgttttgttgcgctcgttgttgtttgggagtcatgcaatcaattttcagaaatggcaatagttgggcatatgtacaggtaac |
10741480 |
T |
|
| Q |
318 |
atcacagataaacaattgattaatat |
343 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
10741481 |
atcacagataaacaattgattaatat |
10741506 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University