View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17303_high_41 (Length: 284)
Name: NF17303_high_41
Description: NF17303
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17303_high_41 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 24 - 276
Target Start/End: Complemental strand, 41697790 - 41697538
Alignment:
| Q |
24 |
ttaattaaaggaagattgccaaatgggctattctttgttgcttatacatatgctggggagcttccaagctctgcatttgcatttaatagcaatggattgg |
123 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41697790 |
ttaattaaaggaatattgccaaatgggctattctttgttgcttatacatatgctggggagcttccaagctctgcatttgcatttaatagcaatggattgg |
41697691 |
T |
 |
| Q |
124 |
taaaaattccctattatttcaaatgatctcttaatattaaagtaagtattaagaacaaaattttctttatgatcattaggcattcactctaaattcagta |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
41697690 |
taaaaattccctattatttcaaatgatctcttaatattaaagtaagtattaagaacaaaatttgctttatgatcattaggcattcactctaaattcagta |
41697591 |
T |
 |
| Q |
224 |
ccaccagctgaagatgaaattgtagctggtgggattgggcgcaacttcatttc |
276 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41697590 |
ccaccagctgaagatgaaattgtagctggtgggattgggcgcaacttcatttc |
41697538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University