View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17303_high_66 (Length: 202)
Name: NF17303_high_66
Description: NF17303
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17303_high_66 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 69; Significance: 4e-31; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 112 - 188
Target Start/End: Complemental strand, 33329108 - 33329032
Alignment:
| Q |
112 |
acccacacccaaccacaattatttggtatccttccagatgttgacagtagcatttgttacccaaagactagaataat |
188 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
33329108 |
acccacacccaaccacaattgtttggtatccttccagatgttgacagtagcatttgttacccaaagacgagaataat |
33329032 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 22 - 125
Target Start/End: Complemental strand, 33329314 - 33329211
Alignment:
| Q |
22 |
gtaccaaaatgattttcaatgtaatctgcttcttccggtgaccnnnnnnntgttgannnnnnnctttctgcatacactacctcaacaataacccacaccc |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||| |||||| |||||||||||||||||||||||||||||||| | || |
|
|
| T |
33329314 |
gtaccaaaatgattttcaatgtaatctgctgcttccggtgaccaaaaaaatgttgatttttttctttctgcatacactacctcaacaataacccaaaacc |
33329215 |
T |
|
| Q |
122 |
aacc |
125 |
Q |
| |
|
|||| |
|
|
| T |
33329214 |
aacc |
33329211 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University