View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17303_low_19 (Length: 389)
Name: NF17303_low_19
Description: NF17303
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17303_low_19 |
 |  |
|
| [»] chr7 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 263; Significance: 1e-146; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 263; E-Value: 1e-146
Query Start/End: Original strand, 13 - 389
Target Start/End: Complemental strand, 48085571 - 48085215
Alignment:
| Q |
13 |
cacagaaagaaatgtttgcactaggattgaatcaaaggaagacattttattactgacaatttgagtgggaaaaccagtactcaagaacttggcatgacaa |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48085571 |
cacagaaagaaatgtttgcactaggattgaaacaaaggaagacattttattactgacaatttgagtgggaaaaccagtactcaagaacttggcatgacaa |
48085472 |
T |
 |
| Q |
113 |
accactagctatggaatacaaaacaaaagattaatggataaattaaagggacacagataaagaaaatacacacataaactaacnnnnnnncattaaccaa |
212 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
48085471 |
accactagctatggaatacaaaacaaaag--------------------gacacagataaagaaaatacacacataaactaacaaaaaaacattaaccaa |
48085392 |
T |
 |
| Q |
213 |
atgtcttggatggattgatcaagtcctggaatctaaggccatgatagtgctgagattcatgggatacatgtactgagcactgcccctaaggatttggttg |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
48085391 |
atgtcttggatggattgatcaagtcctggaatctaaggccatgatagtgctgagattcatgggatacatgtactgagcactgcccctaaggattcggttg |
48085292 |
T |
 |
| Q |
313 |
actatgattttgtttgccttttcagatggatggaatgcatcccaaaatgcattaagttgcatggttgggcacaagtt |
389 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| || ||||||||||||| |
|
|
| T |
48085291 |
actatgattttgtttgccttttcagatggatggaatgcatcccaaaaagcattaagttctctgtttgggcacaagtt |
48085215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 319 - 364
Target Start/End: Complemental strand, 48102536 - 48102491
Alignment:
| Q |
319 |
attttgtttgccttttcagatggatggaatgcatcccaaaatgcat |
364 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48102536 |
attttgtttgccttttcagatggatggaatgcatcccaaaatgcat |
48102491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 325 - 360
Target Start/End: Complemental strand, 1809590 - 1809555
Alignment:
| Q |
325 |
tttgccttttcagatggatggaatgcatcccaaaat |
360 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| |
|
|
| T |
1809590 |
tttgccttttcagatggatggaatggatcccaaaat |
1809555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 44; Significance: 6e-16; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 322 - 365
Target Start/End: Original strand, 7385568 - 7385611
Alignment:
| Q |
322 |
ttgtttgccttttcagatggatggaatgcatcccaaaatgcatt |
365 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7385568 |
ttgtttgccttttcagatggatggaatgcatcccaaaatgcatt |
7385611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000002; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 312 - 364
Target Start/End: Original strand, 35357711 - 35357763
Alignment:
| Q |
312 |
gactatgattttgtttgccttttcagatggatggaatgcatcccaaaatgcat |
364 |
Q |
| |
|
|||||||||| || | || |||||||||||||| ||||||||||||||||||| |
|
|
| T |
35357711 |
gactatgattctgctagctttttcagatggatgaaatgcatcccaaaatgcat |
35357763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 313 - 364
Target Start/End: Original strand, 35376267 - 35376318
Alignment:
| Q |
313 |
actatgattttgtttgccttttcagatggatggaatgcatcccaaaatgcat |
364 |
Q |
| |
|
||||||||| || | || ||||||||||||||||||| |||||||||||||| |
|
|
| T |
35376267 |
actatgattctgctagctttttcagatggatggaatggatcccaaaatgcat |
35376318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University