View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17303_low_26 (Length: 349)
Name: NF17303_low_26
Description: NF17303
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17303_low_26 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 129; Significance: 1e-66; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 129; E-Value: 1e-66
Query Start/End: Original strand, 211 - 339
Target Start/End: Original strand, 2480735 - 2480863
Alignment:
| Q |
211 |
tatagtgttggagaagtagattacagtaaagggtgacgaatttctgagacccatgagccccactgtcgttgtctaactcctctgaacttgttacgttgta |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2480735 |
tatagtgttggagaagtagattacagtaaagggtgacgaatttctgagacccatgagccccactgtcgttgtctaactcctctgaacttgttacgttgta |
2480834 |
T |
|
| Q |
311 |
ccatgatcgattggtgcctaatgcctttg |
339 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
2480835 |
ccatgatcgattggtgcctaatgcctttg |
2480863 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 238 - 299
Target Start/End: Complemental strand, 49532403 - 49532342
Alignment:
| Q |
238 |
aaagggtgacgaatttctgagacccatgagccccactgtcgttgtctaactcctctgaactt |
299 |
Q |
| |
|
|||||||| ||||||||||| ||||| ||||||||||| || || || |||||||||||||| |
|
|
| T |
49532403 |
aaagggtggcgaatttctgacacccaagagccccactggcgctgcctgactcctctgaactt |
49532342 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University