View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17303_low_35 (Length: 308)
Name: NF17303_low_35
Description: NF17303
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17303_low_35 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 184; Significance: 1e-99; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 12180530 - 12180766
Alignment:
| Q |
1 |
cttttgtcctacaaaaaatgatcatagttggtcattttacaaattacttgcagattatttatcactttatctcgacaataaaagttgaattcacacgttt |
100 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
12180530 |
cttttgtcctacaaaaa-tgatcatagttggtcattttacaaattacttgcagattatttatcactttatgtcgacaataaaagttgaattcacacgttt |
12180628 |
T |
 |
| Q |
101 |
atnnnnnnnnntattaactctctataattagatcaacctgcattaaaagagtgaaaatagtttttggtacggtctaagtcgtctcactatttggcatatt |
200 |
Q |
| |
|
|| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
12180629 |
ataaaaaataatattaactctccataattagatcaacctgcattaaaagagtgaaaatagtttttggtacagtctaagtcgtctcactatttggcatatt |
12180728 |
T |
 |
| Q |
201 |
aatttgatggtgtgtaaattcgaacaattgtattggtag |
239 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
12180729 |
aa-ttgatggtgtgtaaattcgaacaattgtattggtag |
12180766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 252 - 292
Target Start/End: Original strand, 12180753 - 12180793
Alignment:
| Q |
252 |
aattgtattggtagaaaatagtggtttttatcaggcccctc |
292 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
12180753 |
aattgtattggtagaaaattgtggtttttatcaggcccctc |
12180793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University