View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17303_low_44 (Length: 273)
Name: NF17303_low_44
Description: NF17303
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17303_low_44 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 117; Significance: 1e-59; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 1 - 142
Target Start/End: Complemental strand, 1419260 - 1419119
Alignment:
| Q |
1 |
acgaaaatatatggaacagcttgaatttggtcnnnnnnngtagaagcagtaagtaaatatcatcaattcatatcaaacaaaacaatcagcaaagtaaaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1419260 |
acgaaaatatatggaacagcttgaatttggtctttttttgtagaagaagtaagtaaatatcatcaattcatatcaaacaaaacaatcagcaaagtaaaat |
1419161 |
T |
|
| Q |
101 |
gagaagcagcgtagtatgtgatgatccaagatgagtcattaa |
142 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1419160 |
gagaagcagcgtagtatgtgatgatccaagatgagtcattaa |
1419119 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 204 - 252
Target Start/End: Complemental strand, 1419006 - 1418958
Alignment:
| Q |
204 |
tgttagggatattagagaaaatacatgaccatccttggttggagtggtg |
252 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
1419006 |
tgttagggatattagaaaaaatacatgaccatccttggttggagtggtg |
1418958 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 131 - 188
Target Start/End: Complemental strand, 1419106 - 1419052
Alignment:
| Q |
131 |
atgagtcattaatttctaaaaagattcattataagaaacgagtaatttgaaagaaaga |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
1419106 |
atgagtcattaatttctaaaaagattcattataagaaacgag---tttgaaagaaaga |
1419052 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University