View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17303_low_47 (Length: 268)
Name: NF17303_low_47
Description: NF17303
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17303_low_47 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 91; Significance: 4e-44; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 91; E-Value: 4e-44
Query Start/End: Original strand, 154 - 252
Target Start/End: Complemental strand, 3703212 - 3703114
Alignment:
| Q |
154 |
ttgtgtgtatacatttgcagaagttagattttattattggcatggactatcaaatatcttgataacaagtattattaagaagtgtgcttttaaaatact |
252 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
3703212 |
ttgtatgtatacatttgcagaagttagattttattattggcatggactatcaaatatcttgataagaagtattattaagaagtgtgcttttaaaatact |
3703114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 38 - 72
Target Start/End: Complemental strand, 3703420 - 3703386
Alignment:
| Q |
38 |
ggtaacatatgtggtagaaggaatgatgcaagtga |
72 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |
|
|
| T |
3703420 |
ggtaacatatgtggtagagggaatgatgcaagtga |
3703386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University