View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17303_low_50 (Length: 265)
Name: NF17303_low_50
Description: NF17303
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17303_low_50 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 3 - 258
Target Start/End: Original strand, 52262988 - 52263243
Alignment:
| Q |
3 |
caacacagaacccactttccgaaatatcgccgtcgccatctccgtcgtcagcgacggcgccagctctggtcctttcaaactcaggaaaacggatcgatca |
102 |
Q |
| |
|
|||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52262988 |
caacccagaacccactttccgaaatatcaccgtcgccatctccgtcgtcagcgacggcgccagctctggtcctttcaaactcaggaaaacggatcgatca |
52263087 |
T |
|
| Q |
103 |
agcagggaagaagaagtacgtaaagcaagtaacgggtcgtcacaacgatactgagcttcatctagcagctcaaagaggtgatgttggtgctgtgagacag |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52263088 |
agcagggaagaagaagtacgtaaagcaagtaacgggtcgtcacaacgatactgagcttcatctagcagctcaaagaggtgatgttggtgctgtgagacag |
52263187 |
T |
|
| Q |
203 |
atccttcttgatattgattctcaaataatgggtactttgagtggtgatgatgatgt |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52263188 |
atccttcttgatattgattctcaaataatgggtactttgagtggtgatgatgatgt |
52263243 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University