View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17303_low_51 (Length: 257)
Name: NF17303_low_51
Description: NF17303
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17303_low_51 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 10 - 239
Target Start/End: Complemental strand, 39975821 - 39975592
Alignment:
| Q |
10 |
aagaatattgttgctagtgactttcgtgctactaggatgagttggtttgactggtattaactattgcaatagaaacttaggtgaaatcgtaaatggagaa |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39975821 |
aagaatattgttgctagtgactttcgtgctactaggatgagttggtttgactggtattaactattgcaatagaaacttaggtgaaatcgtaaatggagaa |
39975722 |
T |
 |
| Q |
110 |
atataacttgtcgtgccaacctatttggtgaagtcgtaaatggagaaatatgacatgctggcccaaccacagtaactaatctaagtgctgcagatggcaa |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
39975721 |
atataacttgtcgtgccaacctatttggtgaagtcgtaaatggagaaatatgacatgctggcccaaccacagtaactaacctaagtgctgcagatggcaa |
39975622 |
T |
 |
| Q |
210 |
cagtctccgtgttacatttacttcctgtca |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
39975621 |
cagtctccgtgttacatttacttcctgtca |
39975592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 53; Significance: 2e-21; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 133 - 209
Target Start/End: Complemental strand, 10995254 - 10995178
Alignment:
| Q |
133 |
tttggtgaagtcgtaaatggagaaatatgacatgctggcccaaccacagtaactaatctaagtgctgcagatggcaa |
209 |
Q |
| |
|
||||||||| |||||||||||||||||| || |||||||||||||| |||||| ||||||||| ||||||||||||| |
|
|
| T |
10995254 |
tttggtgaaatcgtaaatggagaaatataacttgctggcccaaccatagtaaccaatctaagtactgcagatggcaa |
10995178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 44 - 119
Target Start/End: Complemental strand, 10995296 - 10995221
Alignment:
| Q |
44 |
ggatgagttggtttgactggtattaactattgcaatagaaacttaggtgaaatcgtaaatggagaaatataacttg |
119 |
Q |
| |
|
|||||||| |||||| ||||||||| |||||||||||||| || ||||||||||||||||||||||||||||||| |
|
|
| T |
10995296 |
ggatgagtatgtttgattggtattaaatattgcaatagaaagtttggtgaaatcgtaaatggagaaatataacttg |
10995221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University