View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17303_low_52 (Length: 254)
Name: NF17303_low_52
Description: NF17303
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17303_low_52 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 105 - 254
Target Start/End: Complemental strand, 1419389 - 1419240
Alignment:
| Q |
105 |
caaaaatgggaaaagtattattagaagaatttgtcaaggtacaattggaccaagataatatttggaggcctccttcaccagtcttgtctaaagaatttga |
204 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
1419389 |
caaaaatggaaaaaatattattagaagaatttgtcaaggtacaattggaccaagataatatttggaggcctcctccaccagtcttgtctaaagaatttga |
1419290 |
T |
 |
| Q |
205 |
tttaacttaagtagtataatttggtagtaacgaaaatatatggaacagct |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1419289 |
tttaacttaagtagtataatttggtagtaacgaaaatatatggaacagct |
1419240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University