View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17303_low_60 (Length: 227)
Name: NF17303_low_60
Description: NF17303
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17303_low_60 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 96; Significance: 3e-47; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 65 - 221
Target Start/End: Original strand, 19851148 - 19851304
Alignment:
| Q |
65 |
gctcatttaaggttttggtttgatttgcccacaataggtgttaannnnnnngaatttgattaaactcacaccaatactatgatgtgaggagcaaaattag |
164 |
Q |
| |
|
||||||||||||||||| |||||||| ||||||||||||||||| ||||| ||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
19851148 |
gctcatttaaggttttgttttgatttccccacaataggtgttaatttttttgaattcgattaaactaacaccaatactatgatgtgaggagcaaaattag |
19851247 |
T |
 |
| Q |
165 |
tagcattcaataagtaaagtgaactaactgcctcgttcgcactgtgcttcaaaaaac |
221 |
Q |
| |
|
||||||||||||| |||||||| ||||| |||||||||| ||||||||||||||| |
|
|
| T |
19851248 |
tagcattcaataatcaaagtgaagtaactacctcgttcgcgttgtgcttcaaaaaac |
19851304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 116 - 186
Target Start/End: Complemental strand, 16605881 - 16605811
Alignment:
| Q |
116 |
gaatttgattaaactcacaccaatactatgatgtgaggagcaaaattagtagcattcaataagtaaagtga |
186 |
Q |
| |
|
|||||| || ||||||||||||||||||||||| | |||||||||||| ||||| ||||||| ||||||| |
|
|
| T |
16605881 |
gaattttataaaactcacaccaatactatgatgagtggagcaaaattattagcaatcaataaccaaagtga |
16605811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 126 - 169
Target Start/End: Complemental strand, 24911989 - 24911946
Alignment:
| Q |
126 |
aaactcacaccaatactatgatgtgaggagcaaaattagtagca |
169 |
Q |
| |
|
||||| ||||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
24911989 |
aaacttacaccaatactttgatgtgtggagcaaaattagtagca |
24911946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 126 - 174
Target Start/End: Complemental strand, 3904437 - 3904389
Alignment:
| Q |
126 |
aaactcacaccaatactatgatgtgaggagcaaaattagtagcattcaa |
174 |
Q |
| |
|
||||||||||||||||| ||||||| |||||||||||| |||| |||| |
|
|
| T |
3904437 |
aaactcacaccaatactttgatgtgtagagcaaaattagcagcaatcaa |
3904389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University