View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17304_high_29 (Length: 208)
Name: NF17304_high_29
Description: NF17304
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17304_high_29 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 150; Significance: 2e-79; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 9 - 191
Target Start/End: Complemental strand, 42378296 - 42378114
Alignment:
| Q |
9 |
aggagcagagagggagagtttaggggcggagtttagggaggcggtggcggagatggtgcagctattggggaagccgaatttgtcggannnnnnncctggg |
108 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
42378296 |
aggagaagagagggagagtttaggggcggagtttagggaggcggtggcggagatggtgcagctattggggaagccgaatttgtcggatttttttcctggg |
42378197 |
T |
 |
| Q |
109 |
ttggcccggtttgatttgcagggtgttgtgaaagatatgaatgctttggtgcctcgttttgatggaatatttgagaagatgat |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||| |
|
|
| T |
42378196 |
ttggcccggtttgatttgcagggtgttgtgaaagatatgaatgctttggtgcctcgctttgatgggatatttgagaagatgat |
42378114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 71; E-Value: 2e-32
Query Start/End: Original strand, 16 - 191
Target Start/End: Complemental strand, 42394204 - 42394029
Alignment:
| Q |
16 |
gagagggagagtttaggggcggagtttagggaggcggtggcggagatggtgcagctattggggaagccgaatttgtcggannnnnnncctgggttggccc |
115 |
Q |
| |
|
||||||||||| ||||| ||||| |||||| || | | || |||||||||||||| | ||||||||||| ||||| || |||| | |||| | |
|
|
| T |
42394204 |
gagagggagagcttaggagcggaatttaggaagacagcagcagagatggtgcagctcatagggaagccgaacttgtcagatttttttcctgcgctggctc |
42394105 |
T |
 |
| Q |
116 |
ggtttgatttgcagggtgttgtgaaagatatgaatgctttggtgcctcgttttgatggaatatttgagaagatgat |
191 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
42394104 |
ggtttgatttgcagggtattgtgaaagatatgaatcttttggtgcctcgttttgatggaatatttgaaaagatgat |
42394029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University