View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17304_low_24 (Length: 237)
Name: NF17304_low_24
Description: NF17304
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17304_low_24 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 84; Significance: 5e-40; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 1 - 109
Target Start/End: Complemental strand, 35966997 - 35966889
Alignment:
| Q |
1 |
atttcaacttaatcacattatcgctttaatctctttcgtcaattatattatattttaaacattttgacatgtcaaannnnnnngggtatgaaatgtgctc |
100 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
35966997 |
atttcaacttaatcaaattatcgctttaatctctttcgtcaattatattatattttaaacattttgacatgtcaaatttttttgggtatgaaatgtgctc |
35966898 |
T |
 |
| Q |
101 |
cttttgtaa |
109 |
Q |
| |
|
||||||||| |
|
|
| T |
35966897 |
cttttgtaa |
35966889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 98 - 202
Target Start/End: Complemental strand, 35962243 - 35962123
Alignment:
| Q |
98 |
ctccttttgtaataccaatgtgtt---aataacaaagttggaattggcttgatatcaaaattacggttaaa-------------ttgattcaacgtagtt |
181 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||| | ||||||||| |||||||||| ||||| |
|
|
| T |
35962243 |
ctccttttgtaataccaatgtgttgttaataacaaagttggaattggcttgatatcaaagtcacggttaaatacttaaattgatttgattcaacatagtt |
35962144 |
T |
 |
| Q |
182 |
gaattacacgtctaacaataa |
202 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
35962143 |
gaattacacgtctaacaataa |
35962123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University