View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17304_low_25 (Length: 237)
Name: NF17304_low_25
Description: NF17304
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17304_low_25 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 37483758 - 37483538
Alignment:
| Q |
1 |
tgtatatgtttggatggatgaaatggtatagaatgaaatgaaattgaataatttaatg-ttatatcatttgaattcttattaataggatggaacatagtg |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
37483758 |
tgtatatgtttggatggatgaaatggtatagaatgaaatgaaattgaataagttaatggttatatcatttgaattcttattaataggatgtt-catagtg |
37483660 |
T |
 |
| Q |
100 |
aaactcaatgaaatgcatttcatcacatttcatttattcacatttttatgcgcctttccaatttggatggaatgagatggaacagttacttttcaattac |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
37483659 |
aaactcaatgaaatgcatttcatcacatttcatttattcacattttgatgcgcctttccaatttggatggaatgagatggaacagttatttttcaattac |
37483560 |
T |
 |
| Q |
200 |
taaattattgcatgacaaatat |
221 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
37483559 |
taaattattgcatgacaaatat |
37483538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University