View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17304_low_29 (Length: 223)
Name: NF17304_low_29
Description: NF17304
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17304_low_29 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 7 - 170
Target Start/End: Complemental strand, 519073 - 518910
Alignment:
| Q |
7 |
aagaataatatcttgcctcgagaaacatctcttgacaacttccatcttgttcactgttttctttgagtaagggtttgtggggcctgagtgtattggactt |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||| |
|
|
| T |
519073 |
aagaataatatcttgcctcgagaaacatctcttgacaacttccatcttgttcactgttttctttgagtgagtgtttgtggggcctgagtgtattggactt |
518974 |
T |
 |
| Q |
107 |
caccaacgacagttcaagtgcatctcatgggtgaatcattgcccaaatgtgatcagcacatgaa |
170 |
Q |
| |
|
|||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
518973 |
caccaacgacggttcaagtgcatcgcatgggtgaatcattgcccaaatgtgatcagcacatgaa |
518910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University