View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17304_low_8 (Length: 400)
Name: NF17304_low_8
Description: NF17304
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17304_low_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 358; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 358; E-Value: 0
Query Start/End: Original strand, 1 - 382
Target Start/End: Original strand, 25997548 - 25997929
Alignment:
| Q |
1 |
atagaaaaattaaaatgaatggacacttacttttaaccagtttcataacataattttaatctgctcaactattctatccaccgtccatgaagaattctga |
100 |
Q |
| |
|
||||||| ||||||||||| |||||||||||||||||||||||||||||||||||| ||||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
25997548 |
atagaaagattaaaatgaacggacacttacttttaaccagtttcataacataatttaaatctcctccactattctatccaccgtccatgaagaattctga |
25997647 |
T |
 |
| Q |
101 |
agcagtgttttatttcttaatttccatattatccaaacacttgcaaaccaaattgttgaaatccttgtgtggtattatacctccttttggaacaaactca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25997648 |
agcagtgttttatttcttaatttccatattatccaaacacttgcaaaccaaattgttgaaatccttgtgtggtattatacctccttttggaacaaactca |
25997747 |
T |
 |
| Q |
201 |
tgaattacagattcatagctttaacactaattgatgttaatttaagattgctcagtaaccgtcttgcatgttgagtatcacctagtgtggcgtggattgc |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25997748 |
tgaattacagattcatagctttaacactaattgatgttaatttaagattgctcagtaaccgtcttgcatgttgagtatcacctagtgtggcgtggattgc |
25997847 |
T |
 |
| Q |
301 |
atgctacaatcaactcattgattgcgatccatatgctacgttcttattagaacgcgcgactctccatttgggttaatctttt |
382 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
25997848 |
atgctacaatcaactcattgattgcgatccatatgctacgttcttattagaacgcgcgactctccttttgggttaatctttt |
25997929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University