View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17305_high_16 (Length: 223)
Name: NF17305_high_16
Description: NF17305
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17305_high_16 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 5067389 - 5067163
Alignment:
| Q |
1 |
atcatcatttgattggttactttggtgcatgtgttctataaagtctaatgttcctatgttcatgtttcttgttagtggagtggtttttatgtacttggtt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5067389 |
atcatcatttgattggttactttggtgcatgtgttctataa-gtctaatgttcctatgttcatgtttcttgttagtggagtggtttttatgtacttggtt |
5067291 |
T |
 |
| Q |
101 |
ttttagactattccattggtttcattttcttcatattttcttgat-----nnnnnnnnnnnnctactttgatcatcttcccttgcatggcactgtgattt |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5067290 |
ttttagactattccattggtttcattttcttcatattttcttgataaaaaaaaaaaaaaaaactactttgatcatcttcccttgcatggcactgtgattt |
5067191 |
T |
 |
| Q |
196 |
atcacattaattaatcacccttttgaat |
223 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
5067190 |
atcacattaattaatcacccttttgaat |
5067163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University