View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17305_high_6 (Length: 371)
Name: NF17305_high_6
Description: NF17305
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17305_high_6 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 57; Significance: 1e-23; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 294 - 350
Target Start/End: Original strand, 18695756 - 18695812
Alignment:
| Q |
294 |
gggttgacagcttgaatacagaagggattaggcaaagaatgatcaattattggtatt |
350 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18695756 |
gggttgacagcttgaatacagaagggattaggcaaagaatgatcaattattggtatt |
18695812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 19 - 57
Target Start/End: Original strand, 18695484 - 18695522
Alignment:
| Q |
19 |
gaatagaacctcgtagatggatgttgcattggaacttgt |
57 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18695484 |
gaatagaacctcgtagatggatgttgcattggaacttgt |
18695522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University