View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17305_low_14 (Length: 304)
Name: NF17305_low_14
Description: NF17305
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17305_low_14 |
 |  |
|
| [»] scaffold0185 (2 HSPs) |
 |  |  |
|
| [»] scaffold0048 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0185 (Bit Score: 91; Significance: 4e-44; HSPs: 2)
Name: scaffold0185
Description:
Target: scaffold0185; HSP #1
Raw Score: 91; E-Value: 4e-44
Query Start/End: Original strand, 149 - 284
Target Start/End: Original strand, 3750 - 3885
Alignment:
| Q |
149 |
ggacaaatggatcctannnnnnnagttatagaaaatcatttgaagtaatttttaggtactgttatttaaaacgtgtaataaatggatgaaaacttcaaaa |
248 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||| |||||| ||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3750 |
ggacaaatggatcctatttttttagttatagaaaatcatttgaagtagtttttacataccgttatttaaaacgtgtaataaatggatgaaaacttcaaaa |
3849 |
T |
 |
| Q |
249 |
attattatatttgtttttagagtaaatacctctttt |
284 |
Q |
| |
|
|||||||||||||||||||| ||||||| ||||||| |
|
|
| T |
3850 |
attattatatttgtttttagggtaaatatctctttt |
3885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0185; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 18 - 67
Target Start/End: Original strand, 3619 - 3668
Alignment:
| Q |
18 |
agagacgaacaactaaagaggaaataacaatcaaagagatgaaccatcat |
67 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
3619 |
agagacgaacaactaaagaggaattaacaatcaaagagatgaaccatcat |
3668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0048 (Bit Score: 57; Significance: 8e-24; HSPs: 1)
Name: scaffold0048
Description:
Target: scaffold0048; HSP #1
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 172 - 267
Target Start/End: Original strand, 62344 - 62440
Alignment:
| Q |
172 |
agttatagaaaatcatttgaagtaatttttaggtactg-ttatttaaaacgtgtaataaatggatgaaaacttcaaaaattattatatttgttttta |
267 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| || || ||||| | || |||||| ||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
62344 |
agttatagaaaatcatttgaagtagtttttagatattgattattaataatgtgtaacaaatggatgaaaagttcaaaaattattatatttgttttta |
62440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University