View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17306_high_9 (Length: 226)
Name: NF17306_high_9
Description: NF17306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17306_high_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 14 - 209
Target Start/End: Original strand, 42559324 - 42559516
Alignment:
| Q |
14 |
gatgaaaggagtgtgagatgtaagaaaggagaaagtagtgtctgtggatgatgatgatgatgtgtggagttttgatctgaggataggatgggaattttgt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42559324 |
gatgaaaggagtgtgagatgtaagaaaggagaaagtagtgtctgtggatg---atgatgatgtgtggagttttgatctgaggataggatgggaattttgt |
42559420 |
T |
 |
| Q |
114 |
agtttgtggagtgaggtttgaaaacgggaaatatcaatgggttttgtgatgagtagtgataaaactgcaatgccggtgccaccacgaatggctttg |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42559421 |
agtttgtggagtgaggtttgaaaacgggaaatatcaatgggttttgtgatgagtagtgataaaactgcaatgccggtgccaccacgaatggctttg |
42559516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 90 - 126
Target Start/End: Complemental strand, 25993977 - 25993941
Alignment:
| Q |
90 |
ctgaggataggatgggaattttgtagtttgtggagtg |
126 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
25993977 |
ctgaggataggatgggaattttggagtttgtggagtg |
25993941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University