View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17306_low_8 (Length: 242)
Name: NF17306_low_8
Description: NF17306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17306_low_8 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 49; Significance: 4e-19; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 59 - 111
Target Start/End: Original strand, 14279009 - 14279061
Alignment:
| Q |
59 |
tgtgcccactgtttttgtttctaatttatgaacaaaactgcctcagctcttac |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
14279009 |
tgtgcccactgtttttgtttctaatttatgaacaaaactgtctcagctcttac |
14279061 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 175 - 236
Target Start/End: Original strand, 14279851 - 14279911
Alignment:
| Q |
175 |
gaataaattgaaccgaaactgtatgaaatgaaacagttttatttcttaatttgtaattcatt |
236 |
Q |
| |
|
|||| |||||| ||||||| ||| ||| ||||||||||||||||| |||||||||||||||| |
|
|
| T |
14279851 |
gaatgaattgagccgaaaccgtaagaagtgaaacagttttatttc-taatttgtaattcatt |
14279911 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University