View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17307_low_4 (Length: 310)
Name: NF17307_low_4
Description: NF17307
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17307_low_4 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 278; Significance: 1e-155; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 18 - 310
Target Start/End: Complemental strand, 55630 - 55335
Alignment:
| Q |
18 |
ggatctgtgatgattatcatgttgaagagatgaatta---gaagaagaattgagtaaagcaaaggaatgagagggatgacgacgagaagcagaggctttg |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55630 |
ggatctgtgatgattatcatgttgaagagatgaattattagaagaagaattgagtaaagcaaaggaatgagagggatgacgacgagaagcagaggctttg |
55531 |
T |
 |
| Q |
115 |
atggcctgagcagcaagggaattagtattgataattggaggagcgctatttggttcattatcatctaacaattcatgtcgcccattaatattaatatctt |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55530 |
atggcctgagcagcaagggaattagtattgataattggaggagcgctatttggttcattatcatctaacaattcatgtcgcccattaatattaatatctt |
55431 |
T |
 |
| Q |
215 |
ccttgaaggtcgaactccttgatacaacctgctttctcctatatgccattatcaatcaaccaccgtaaccccctattacaaaaacaaacaactctc |
310 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
55430 |
ccttgaaggtcgaactccttgatacaacctgctttctcctatatgccattatcaatcaaccaccgcaaccccctattacaaaaacaaacaactctc |
55335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 73 - 135
Target Start/End: Original strand, 27702163 - 27702225
Alignment:
| Q |
73 |
gcaaaggaatgagagggatgacgacgagaagcagaggctttgatggcctgagcagcaagggaa |
135 |
Q |
| |
|
||||||||| ||| ||| |||||||||| || ||||||||||||||| ||||| || |||||| |
|
|
| T |
27702163 |
gcaaaggaaagagcgggttgacgacgagcagtagaggctttgatggcttgagcggcgagggaa |
27702225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University