View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17307_low_5 (Length: 251)
Name: NF17307_low_5
Description: NF17307
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17307_low_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 42 - 237
Target Start/End: Original strand, 37344701 - 37344896
Alignment:
| Q |
42 |
gaatcatgattttaataagataaaatagcataaattaatgaccatgaactatgttttggaaggcatgtaaaatataagaaaccatataaaaattcatgtt |
141 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
37344701 |
gaatcatgattttgataagataaaatagcataaattaatgaccatgaactatgttttggaaggcatgtaaaatataagaaaccatataaaaattaatgtt |
37344800 |
T |
 |
| Q |
142 |
ttggaagacacaagacatgtccaaaaaacaaaattgaatgcactaattatacaacttctacatgtaaaggagtggcagtaggattctccaagattt |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37344801 |
ttggaagacacaagacatgtccaaaaaacaaaattgaatgcactaattatacaacttctacatgtaaaggagtggcagtaggattctccaagattt |
37344896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University