View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17308_high_11 (Length: 303)
Name: NF17308_high_11
Description: NF17308
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17308_high_11 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 45 - 303
Target Start/End: Original strand, 34899398 - 34899656
Alignment:
| Q |
45 |
cccttttgttttgacacttctctaattgtttcttgtggtgctatttggatccttcttaaactcaacttgtatttattgggatctctttttcgtttaatat |
144 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34899398 |
cccttttgttttgacacttctctaattgtttcttgtggtgctatttggatccttcttaaactcaacttgtatttattgggatctctttttcgtttaatat |
34899497 |
T |
 |
| Q |
145 |
aatttttgacttcttcaacnnnnnnnntctatgaagaagtgtctgctaagacttacaaataattagttggtagctgaatgcagaaaattgaatatcgaaa |
244 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34899498 |
aatttttgacttcttcaacaaaaaaaatctatgaagaagtgtctgctaagacttacaaataattagttggtagctgaatgcagaaaattgaatatcgaaa |
34899597 |
T |
 |
| Q |
245 |
gtgtgtctctaaaaatgttcttagttattaggagaacctcaattagtgggtcagttgac |
303 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
34899598 |
atgtgtctctaaaaatgttcttagttattaggagaacctcaactagtgggtcagttgac |
34899656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University