View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17309_high_30 (Length: 238)
Name: NF17309_high_30
Description: NF17309
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17309_high_30 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 19 - 220
Target Start/End: Original strand, 32728779 - 32728980
Alignment:
| Q |
19 |
atgaagcaagaagtgtacaaaattacaatggcacatggtacatacatatatataattagcaaatattatttggctctcacttccagttattggcaacaat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
32728779 |
atgaagcaagaagtgtacaaaattacaatggcacatggtacatacatatatataattagcaaatattattcggctctcacttccagttattggcaacaat |
32728878 |
T |
 |
| Q |
119 |
gtcagccaaatcaacaaccctttgtgagtaaccccattcattatcataccaagcaatcaccttaaccatgtcatctcccataaccattgtcaatgacgaa |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32728879 |
gtcagccaaatcaacaaccctttgtgagtaaccccattcattatcataccaagcaatcaccttaaccatgtcatctcccataaccattgtcaatgacgaa |
32728978 |
T |
 |
| Q |
219 |
tc |
220 |
Q |
| |
|
|| |
|
|
| T |
32728979 |
tc |
32728980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 146 - 211
Target Start/End: Original strand, 54181164 - 54181229
Alignment:
| Q |
146 |
gtaaccccattcattatcataccaagcaatcaccttaaccatgtcatctcccataaccattgtcaa |
211 |
Q |
| |
|
||||||||||||||| ||||||||||||| |||||| ||||| ||||||||||| ||||| ||||| |
|
|
| T |
54181164 |
gtaaccccattcattgtcataccaagcaaccaccttgaccatatcatctcccatgaccatagtcaa |
54181229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University