View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17309_high_38 (Length: 207)
Name: NF17309_high_38
Description: NF17309
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17309_high_38 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 117; Significance: 8e-60; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 117; E-Value: 8e-60
Query Start/End: Original strand, 61 - 189
Target Start/End: Complemental strand, 25742871 - 25742743
Alignment:
| Q |
61 |
tgaacattttagctatgtggattcagaaaaggccaagttgaatgaaaaggaacttcttgaaaagttacttttggaatggagtgagaatgctgatactgac |
160 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
25742871 |
tgaacatgttagctatgtggattcagaaaaggccaagttgaatgaaaaggaacttcttgaaaagttaattttggaatggggtgagaatgctgatactgac |
25742772 |
T |
 |
| Q |
161 |
aattcacaacaagaaaaagacatactaga |
189 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
25742771 |
aattcacaacaagaaaaagacatactaga |
25742743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 38
Target Start/End: Complemental strand, 25742907 - 25742870
Alignment:
| Q |
1 |
ttccattgatgaactaggagaattatctgatttacatg |
38 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
25742907 |
ttccattgatgaaataggagaattatctgatttacatg |
25742870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University