View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17309_high_39 (Length: 205)
Name: NF17309_high_39
Description: NF17309
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17309_high_39 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 18 - 191
Target Start/End: Complemental strand, 5516610 - 5516437
Alignment:
| Q |
18 |
atagtaacagttcagtttggtttaattttcttcttgaaccgaaccataaacaatctaaaataccacaattgttaccacaggtcaggaatggaacaaaaac |
117 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
5516610 |
atagtaacagttcagtttggtttagttttcttcttgaaccgaaccataaacaatctaaaataccacagttgttactacaggtcaggaatggaacaaaaac |
5516511 |
T |
 |
| Q |
118 |
gagtttgagggagataaaatcaaagctaaatttgctcaaaaggtatatatttattggcttcaggtctacttcat |
191 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5516510 |
gagtttgagggagataaaatcaaagcgaaatttgctcaaaaggtatatatttattggcttcaggtctacttcat |
5516437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 22 - 64
Target Start/End: Complemental strand, 36928031 - 36927989
Alignment:
| Q |
22 |
taacagttcagtttggtttaattttcttcttgaaccgaaccat |
64 |
Q |
| |
|
|||||||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
36928031 |
taacagttcagtttggtttaattttcatctcaaaccgaaccat |
36927989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University