View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17309_low_12 (Length: 386)
Name: NF17309_low_12
Description: NF17309
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17309_low_12 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 226; Significance: 1e-124; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 67 - 370
Target Start/End: Original strand, 39385141 - 39385459
Alignment:
| Q |
67 |
gaaggcttagccgtgtgctaatgattaatgcagtggaggtctctttcagggcagcacataaagaagacaggtgtaaatctgcttcagttgcaatagttgt |
166 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39385141 |
gaaggcttagccgtgtgctaatgattaatgcagtggaggtctctttcagggcagcacataaagaagacaggtgtaaatctgcttcagttgcaatagttgt |
39385240 |
T |
|
| Q |
167 |
ggccagccatacaaaacaagagatgaatgatgttattaatttaattagtacgaatcaaatcaatagctataataaactaaaacaatacagagaatattct |
266 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39385241 |
ggccagccat-caaaacaagagaagaatgatgttattaatttaattagtacgaatcaaatcaatagctataataaactaaaacaatacagagaatattct |
39385339 |
T |
|
| Q |
267 |
tggtcaaagggaacaaa--------------------caatgcagcaatgcttgcttggtgtcattatttatatcaacatcaagcaatagcagaacgggg |
346 |
Q |
| |
|
||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39385340 |
tggtcaaagggaacaaataaatttgtaactttgatgccaatgcagcaattcttgcttggtgtcattatttatatcaacatcaagcaatagcagaacggg- |
39385438 |
T |
|
| Q |
347 |
tgtgtgtattacatatgaagaaat |
370 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
39385439 |
---gtgtattacatatgaagaaat |
39385459 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 7 - 61
Target Start/End: Original strand, 39384657 - 39384711
Alignment:
| Q |
7 |
ctgagatgaaaataaaattagtgctagtaatggggatattgcttaatatagaaaa |
61 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
39384657 |
ctgaaatgaaaataaaattagtgctagtaatggggacattgcttaatatataaaa |
39384711 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University