View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17309_low_28 (Length: 257)
Name: NF17309_low_28
Description: NF17309
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17309_low_28 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 88; Significance: 2e-42; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 130 - 257
Target Start/End: Original strand, 9462954 - 9463081
Alignment:
| Q |
130 |
tgtcgtattatttgtatcttaacaataatattatgatgaaaatttaatttcaaccaacacgttttactggaaacnnnnnnnnattgattacacgccatta |
229 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| |||| ||||||||||||||||||||||||||||||| |||||| ||||||||||| |
|
|
| T |
9462954 |
tgtcgtattatttgtatcttaaaaataatattatgataaaaaattaatttcaaccaacacgttttactggaaacttttttttattgatcacacgccatta |
9463053 |
T |
 |
| Q |
230 |
ttctatttaaatattttttgggtacttt |
257 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
9463054 |
ttctatttaaatattttttgggtacttt |
9463081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University