View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17309_low_28 (Length: 257)

Name: NF17309_low_28
Description: NF17309
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17309_low_28
NF17309_low_28
[»] chr5 (1 HSPs)
chr5 (130-257)||(9462954-9463081)


Alignment Details
Target: chr5 (Bit Score: 88; Significance: 2e-42; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 130 - 257
Target Start/End: Original strand, 9462954 - 9463081
Alignment:
130 tgtcgtattatttgtatcttaacaataatattatgatgaaaatttaatttcaaccaacacgttttactggaaacnnnnnnnnattgattacacgccatta 229  Q
    |||||||||||||||||||||| |||||||||||||| |||| |||||||||||||||||||||||||||||||        |||||| |||||||||||    
9462954 tgtcgtattatttgtatcttaaaaataatattatgataaaaaattaatttcaaccaacacgttttactggaaacttttttttattgatcacacgccatta 9463053  T
230 ttctatttaaatattttttgggtacttt 257  Q
    ||||||||||||||||||||||||||||    
9463054 ttctatttaaatattttttgggtacttt 9463081  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University