View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17309_low_42 (Length: 207)

Name: NF17309_low_42
Description: NF17309
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17309_low_42
NF17309_low_42
[»] chr2 (2 HSPs)
chr2 (61-189)||(25742743-25742871)
chr2 (1-38)||(25742870-25742907)


Alignment Details
Target: chr2 (Bit Score: 117; Significance: 8e-60; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 117; E-Value: 8e-60
Query Start/End: Original strand, 61 - 189
Target Start/End: Complemental strand, 25742871 - 25742743
Alignment:
61 tgaacattttagctatgtggattcagaaaaggccaagttgaatgaaaaggaacttcttgaaaagttacttttggaatggagtgagaatgctgatactgac 160  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||    
25742871 tgaacatgttagctatgtggattcagaaaaggccaagttgaatgaaaaggaacttcttgaaaagttaattttggaatggggtgagaatgctgatactgac 25742772  T
161 aattcacaacaagaaaaagacatactaga 189  Q
    |||||||||||||||||||||||||||||    
25742771 aattcacaacaagaaaaagacatactaga 25742743  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 38
Target Start/End: Complemental strand, 25742907 - 25742870
Alignment:
1 ttccattgatgaactaggagaattatctgatttacatg 38  Q
    ||||||||||||| ||||||||||||||||||||||||    
25742907 ttccattgatgaaataggagaattatctgatttacatg 25742870  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University