View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17309_low_44 (Length: 205)
Name: NF17309_low_44
Description: NF17309
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17309_low_44 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 164; Significance: 7e-88; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 164; E-Value: 7e-88
Query Start/End: Original strand, 18 - 189
Target Start/End: Original strand, 10216796 - 10216967
Alignment:
| Q |
18 |
agaaatggaacgagaaaacagccaagactgtaatccagttggctcatacattaggctgcatatcatggaagtacccactggtgttgcttcaaagttatgt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10216796 |
agaaatggaacgagaaaacagccaagactgtattccagttggctcatacattaggctgcatatcatggaagtacccactggtgttgcttcaaagttatgt |
10216895 |
T |
 |
| Q |
118 |
atactttcaaagacaacaccggttacagcatgtggtctgctcgaacacgaaaacgaagtttctgtccttcat |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
10216896 |
atactttcaaagacaacaccggttacagcatgtggtctgctggaacacgaaaacgaagtttctgtccttcat |
10216967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 44; Significance: 3e-16; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 53 - 152
Target Start/End: Complemental strand, 53887074 - 53886975
Alignment:
| Q |
53 |
cagttggctcatacattaggctgcatatcatggaagtacccactggtgttgcttcaaagttatgtatactttcaaagacaacaccggttacagcatgtgg |
152 |
Q |
| |
|
||||||||||||| |||||||||||||| |||||| |||| || |||||| ||||| ||||||||| || |||||||||| ||| ||||| ||||||| |
|
|
| T |
53887074 |
cagttggctcatatgctaggctgcatatcaaggaagtgcccagtgctgttgcatcaaaattatgtataattgcaaagacaaccccgattacaacatgtgg |
53886975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University